"Computing Life" in PDFComputing Genetics
CSD: Crime Scene DNA
In 1995, a Louisiana nurse accused her ex-boyfriend, a doctor, of attempted murder. She claimed he gave her the AIDS virus by injecting her with blood from an HIV-positive patient. Lawyers from both sides recruited scientists to analyze viral DNA from the nurse.
Who do you think is guilty?
Evidence from a crime scene leads police to five suspects. Compare DNA from the perpetrator's blood left at the crime scene with the suspects' DNA below.DNA sequence from perpetrator's blood found at the crime scene: AGGCTGCCTACGCGGTTAGG
DNA sequences from suspects:
#1 AGGATGGCTACCCGGTTAGG
#2 AGGCTGCCTCAGCGGATAGG
#3 AGGCTGCCTACGCGGTTAGG
#4 CGGCAGCCTACTCGGTTAGG
#5 AGGCTGGATACGCGGCTAGG
In the Louisiana murder trial, scientists compared more than 2,000 letters of HIV from about 30 people. Computers did most of the work!
The answer is: #3.
To prove its case, the prosecution had to convince the jury that the virus from the nurse and the virus from the patient were close relatives. So, scientists dusted for DNA fingerprints!
The investigative team, led by computational biologist David Hillis at the University of Texas at Austin and virologist Michael Metzker at Baylor College of Medicine in Houston, Texas, used a technique called DNA fingerprinting to compare the DNA sequences from the two viral samples. The team also used a number of different computer programs to piece together how the viral sequences most likely changed between the alleged injection in 1994 and the trial in 1998.
The results showed that certain genetic sequences from the nurse's virus were identical to those of the patient's virus. The doctor was convicted of attempted second-degree murder and sentenced to 50 years in prison. Lawyers appealed his case all the way up to the U.S. Supreme Court, which let the conviction stand in 2002.
The case marks the first time that such genetic analysis, called phylogenetics, was used as evidence in a U.S. criminal court.
Social Media Links